• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention relates to an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris, its production process, a cosmetic or dermatological composition containing it, as well as its cosmetic and dermatological uses, especially in the treatment of cutaneous signs of aging.
    公开号:FR3044226A1
    申请号:FR1561400
    申请日:2015-11-26
    公开日:2017-06-02
    发明作者:Serge Holderith；Anais Tromeur；Irina Berlin；Xavier Fernandez；Alexandre Casale；Johannes Grillari；Ingo Lammermann；Florian Gruber；Marie-Sophie Narzt
    申请人:Centre National de la Recherche Scientifique CNRS；Universite de Nice Sophia Antipolis UNSA；Chanel Parfums Beaute SAS；
    IPC主号:
    专利说明:

    Alcoholic extract of aerial parts of Solidago virgaurea subsp. The invention relates to an extract of aerial parts of Solidago virgaurea subsp. alpestris, its production process, a cosmetic or dermatological composition containing it, as well as various cosmetic uses.
    The skin consists mainly of three layers, namely, starting from the most superficial, the epidermis, the dermis and the hypodermis. The epidermis largely contributes to the protection of the skin and to maintain its proper functioning.
    The aging and photo-aging of the skin and the associated alterations can be manifested in different ways, among which we can mention: the loss of firmness and elasticity due to tissue loss in the epidermis and / or dermis; the loss of brightness due to the reduction of the microcirculation and to a slowing down of the cellular renewal at the level of the epidermis; the appearance of pigment spots; and / or skin dryness resulting from a decrease in the barrier function of the stratum corneum and a slowing of epidermal renewal.
    There is, therefore, a need to provide a polyfunctional active agent capable of acting on a set of causes of skin damage due to aging and / or a modification of the physiological mechanisms associated with aging.
    Now, the Applicant has now found that an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris, obtained by a particular process, presents, by means of stimulation or inhibition of physiological mechanisms, interesting activities with regard to skin aging, and the pigmentation and microcirculation of the skin. Indeed, as demonstrated by examples, the alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention has interesting cosmetic properties: it makes it possible to combat the aging of the skin, in particular by its anti-MMP3 and anti-MMP9 actions; has antioxidant properties; activates cutaneous microcirculation; and exhibits depigmenting activity. The extract according to the invention also has an anti-aging effect on the skin, since it makes it possible to delay replicative senescence, prevents the transition of papillary fibroblasts into reticular fibroblasts, and reduces the expression of senescence markers. The invention thus relates, in a first aspect, to an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris, obtainable by a process comprising the following steps: a) extraction of the aerial parts of Solidago virgaurea subsp. alpestris, with at least one alcoholic solvent; b) incubation of the mixture obtained in a) for at least 10 h; c) filtering the incubated mixture obtained in b); and d) removing the solvent from the obtained filtrate and then final dilution in another alcoholic solvent.
    Such an extract is thus called, in the present application, extracted according to the invention. The invention also relates to a method for extracting aerial parts of Solidago virgaurea subsp. alpestris, comprising the following steps: a) extraction of aerial parts of Solidago virgaurea subsp. alpestris, with at least one alcoholic solvent; b) incubation of the mixture obtained in a) for at least 10 h; c) filtering the incubated mixture obtained in b); and d) removing the solvent from the obtained filtrate and then final dilution in another alcoholic solvent. The invention also relates to a cosmetic or dermatological composition comprising, in a cosmetically or pharmaceutically acceptable vehicle, an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention. By cosmetically or pharmaceutically acceptable vehicle is meant a medium compatible with the skin, the mucous membranes and the integuments. Preferably, the cosmetic or dermatological composition according to the invention is suitable for topical application.
    The process for obtaining the extract according to the invention thus comprises the following steps: a) extraction of the aerial parts of Solidago virgaurea subsp. alpestris, with at least one alcoholic solvent; b) incubation of the mixture obtained in a) for at least 10 h; c) filtering the incubated mixture obtained in b); and d) removing the solvent from the obtained filtrate and then final dilution in another alcoholic solvent.
    The raw material used consists of the aerial parts of
    Solidago virgaurea subsp. alpestris.
    Solidago virgaurea subsp. alpestris is a plant with yellow flowers of the family Asteraceae, found in the Provence Alpes Côte d'Azur region. The genus Solidago is part of the family Asteraceae (Asteraceae). It comprises from 156 to 377 species, including the species Solidago virgaurea Z, commonly called solidage, goldenrod or golden sheaf. The subspecies Solidago virgaurea subsp. alpestris (Waldst. & Kit.) Gremli, named Petit Solidage, Petite Verge-d'or or even Alpine Solidage, stands for Solidago alpestris Waldst. & Kit. It is a perennial herbaceous plant, with erect purple flowering stems. The leaves are more or less covered with hair, simple, alternate, oval and lanceolate, with a toothed edge. The yellow flowers are grouped in capitules with 6 to 12 flowers, themselves arranged in a cluster. Flowering takes place from July to September. The fruits are yellowish cylindrical achenes.
    The subspecies alpestris is distinguished from the main species Solidago virgaurea by its small size (5 to 30 cm instead of 1m), the small number of flower heads, which are also slightly larger, and the fact that it grows higher in altitude. The subspecies Solidago virgaurea subsp. alpestris appears at the end of the season in screes and rocky slopes. It grows in altitude between 1400 to 2800 meters in the mountainous regions of Northern Europe.
    There are other subspecies, different from the subspecies of interest according to the invention. In particular, we find the Solidago virgaurea subsp. asiatica Kitam. ex Hara, having for synonyms Solidago japonica var. japonica and Solidago japonica Kitam. This subspecies Solidago virgaurea subsp. asiatica Kitam. ex Hara is 35 to 85 cm tall and flowers from August to November. It is distributed in Japan, Korea, Russia, China and Philippines.
    The aerial parts of Solidago virgaurea subsp. Alpestris used according to the invention are typically selected from flowers, leaves, stems and mixtures thereof. Preferably, the aerial parts used are a mixture of flowers, leaves and stems of Solidago virgaurea subsp. alpestris. Preferably, these aerial parts are previously dried, and then ground or reduced to pieces in the usual manner.
    In step a), the aerial parts are subjected to extraction with one or more alcoholic solvents, for example chosen from: - C 1 -C 4 monoalcohols, such as for example methanol, ethanol or isopropanol; and diols, such as, for example, propylene glycol, 1,3-propanediol or dipropylene glycol.
    Preferably, the alcoholic solvent is a monoalcohol comprising 2 to 4 carbon atoms, more preferably ethanol. The extraction is generally carried out by gently immersing or agitating the aerial parts in one or more of the abovementioned solvents at temperatures ranging, for example, from room temperature to 80 ° C., for a period of about 30 minutes. at 8 o'clock. Preferably, the extraction of step a) is carried out for a period of between 2 and 6 hours at a temperature of between 40 ° C. and 60 ° C.
    The mixture obtained in step a) is then incubated for at least 10 h: this is step b). Preferably, the incubation of step b) is carried out for a period of between 12 h and 30 h at a temperature of between 2 ° C. and 10 ° C. More preferably, the incubation is carried out for 12h to 15h at a temperature of about 4 ° C.
    The incubated mixture obtained at the end of step b) is then filtered to remove insoluble substances: this is step c). Preferably, the filtration of the extract obtained in b) is carried out on a 100 μm membrane. A liquid filtrate is thus obtained.
    Finally, the solvent present in the liquid filtrate is removed and the remainder of the filtrate is diluted in another alcoholic solvent: this is step d). The alcoholic solvent used in step d) is called "other alcoholic solvent" because it is different from the alcoholic solvent used in step a). In view of this limitation, the alcoholic solvent is typically selected from the same group as that of step a), i.e. from C1-C4 monoalcohols and diols.
    Preferably, the removal of the solvent from step d) is by evaporation. Preferably, the final dilution is carried out in a diol, preferably 1,3-propanediol.
    Preferably, between steps c) and d), a fading step of the filtrate obtained in c) is added. The discoloration can be done by adsorption of the pigments present in the filtrate on activated charcoal. This bleaching step may be followed by a filtration step of the discolored filtrate obtained, in particular on a 20 μm membrane.
    Preferably, the alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention is obtainable by a process comprising the following steps: a) extraction of a mixture of flowers, leaves and stems of Solidago virgaurea subsp. alpestris, previously dried and crushed, with ethanol, at a temperature between 40 ° C and 60 ° C for 2h to 5h; b) incubating the mixture obtained in a) for at least 12 h at a temperature between 2 ° C and 6 ° C; c) filtering the incubated mixture obtained in b) to obtain a filtrate; - decolorization of the filtrate obtained in c) by adsorption on activated carbon; then - filtration of the decolorized filtrate on a membrane of 20 μm; and d) removing ethanol from the filtrate obtained by evaporation and then final dilution in 1,3-propanediol.
    Advantageously, the extract used according to the invention is light in color.
    Also, said extract is in a form sufficiently concentrated to be used without causing the formulation problems usually encountered at the concentrations necessary to obtain an activity in cosmetic or dermatological compositions in the form of an emulsion, and without having a dark color, unlike with plant extracts obtained by usual methods, when they are in concentrated form.
    As a result, the extract according to the invention can be used directly for the preparation of a cosmetic or dermatological composition.
    According to a further aspect, the invention relates to the cosmetic use of an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention, as an antioxidant, and / or a depigmenting agent, and / or agent improving the cutaneous microcirculation, and / or for the prevention and / or the attenuation of skin deteriorations due to aging.
    Indeed, advantageously, it has been found that the alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention has several activities of interest vis-à-vis physiological mechanisms preventive or repair related to skin changes, due in particular to aging. The invention therefore relates, more particularly, to the cosmetic use of an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention as an inhibitory agent for melanin synthesis.
    It has also been found that, advantageously, the alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention has an advantageous activity with respect to the secretion of VEGF and cytokine IL la by keratinocytes. VEGF or vascular endothelial growth factor (vascular endothelial growth factor) which represents in the skin a major factor of cutaneous angiogenesis. The epidermis is an important source of VEGF secreted in large quantities by proliferating keratinocytes. VEGF mRNA is expressed by normal keratinocytes, both in tissue in situ and in cell culture. VEGF has been shown to maintain endothelial cell homeostasis and their ability to respond to angiogenic stimulation, even in the elderly (Watanabe Y et al., 1997, Oncogene 14: 2025-2032). On the other hand a decrease in VEGF has been observed following exposure to UV radiation (Photochem Photobiol., 1999; 70 (4): 674-9). The invention also relates to the use of an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention as activating agent for the secretion of VEGF and / or as inhibitory agent for the secretion of ILla by keratinocytes. The invention also relates more particularly to the cosmetic use of an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention for the prevention and / or the attenuation of skin disorders due to aging, in particular by its inhibitory action on metalloproteinases, in particular MMP3 and MMP9. The alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention can therefore be used as an inhibitory agent for the activity of matrix metalloproteinases (called MMPs for "matrix metalloprotease"). Matrix metalloproteinases are enzymes that degrade the extracellular matrix as part of the physiological remodeling of the skin, but age and exposure to UV irradiation have the effect of increasing the activity of specific MMPs, including MMP3 and the MMP9. As a result, the extracellular matrix is degraded further, resulting in sagging skin tissue and wrinkling (Ageing Res, Rev., 2002, 1 (4): 705-20; J. Invest Dermatol 2001, 117 (5): 1218-24). The invention also relates, in a further aspect, to a cosmetic or dermatological composition comprising, in a cosmetically or pharmaceutically acceptable vehicle, an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to the invention. Preferably, said extract is present in the cosmetic or dermatological composition in a proportion of 0.001 to 10% by total weight of the composition, in particular in a proportion of 0.01 to 10%, preferably 0.1 to 10% by weight. total of the composition. Said cosmetic or dermatological composition can in particular be adapted to topical application.
    Advantageously, said cosmetic or dermatological composition may be in the form of a powder, an emulsion, a microemulsion, a nanoemulsion, a suspension, a solution of a lotion, a cream, an aqueous or hydroalcoholic gel, a foam, a serum, an aerosol solution or dispersion, or a dispersion of lipid vesicles.
    In the case of an emulsion, it may be a water-in-oil or oil-in-water emulsion.
    The cosmetic or dermatological composition according to the invention may also comprise a solvent chosen according to the different ingredients and the form of administration. By way of examples, mention may be made of water (preferably deionized water), an alcohol such as ethanol, or a diethylene glycol ether such as ethoxydiglycol or diethylene glycol monomethyl ether.
    Said cosmetic composition may also comprise at least one additive customary in the field, such as for example at least one compound chosen from an emollient or humectant, a gelling and / or thickening agent, a surfactant, an oil, an active agent, a dye, a preservative, an antioxidant, an active agent, an organic or inorganic powder, a sunscreen and a perfume.
    In particular, said composition may contain:
    One or more emollient (s) or humectant (s), which may be chosen for example from glycerin, glycols, water-soluble silicones such as that sold under the name KF6011 (Shin Etsu) and the Water-soluble Jojoba, such as that sold under the name Resplanta jojoba (Res pharma).
    Said emollient or humectant may be present in the composition at a content of the order of 0 to 30%, preferably 2 to 10% by weight, relative to the total weight of the composition.
    One or more agent (s) gelling and / or thickening (s) of the aqueous phase, chosen for example from cellulose derivatives, gums of plant origin (guar, carob, alginates, carrageenans, pectin), microbial origin (xanthan), clays (laponite), materials identified by the INCI names "ammonium acryloyldimethyltaurate / vp copolymer" and "ammonium acryloyldimethyl-taurate / beheneth-25 methacrylate copolymer" (such as for example those sold under the names Aristoflex Stroke and HMB by Clariant).
    Said gelling agent and / or thickener may be present in the composition at a content of about 0 to 10% by weight, relative to the total weight of the composition.
    One or more surfactant (s), preferably nonionic, present in a content of the order of 0 to 8%, preferably 0.5 to 3% by weight, relative to the total weight of the composition .
    One or more fatty substances liquid at room temperature, commonly known as (s) oil (s), volatile (s) or nonvolatile (s), hydrocarbon (s) or silicone (s), linear (s), cyclic (S) or branched (s), for example, isododecane, cyclopentadimethylsiloxane, dimethicones, isononyl isononanoate or pentaerythrityl tetraisostearate, preferably from 0 to about 10%, preferably 0.5 to 5% by weight, relative to the total weight of the composition.
    One or more active agent (s), of natural or synthetic origin, having a biological activity, for example chosen from vitamins, trace elements, allantoin, vegetable proteins and plant extracts.
    One or more water-soluble dyes such as, for example, the disodium salt of a culvert, the disodium salt of alizarin green, quinoline yellow, the trisodium salt of amaranth, the disodium salt of tartrazine, the monosodium salt of rhodamine, the disodium salt of fuchsin or xanthophyll, preferably from 0 to about 2% by weight, relative to the total weight of the composition. Other additives usually used in cosmetics may also be present in the composition according to the invention, especially preservatives, antioxidants or perfumes well known in the technical field. Those skilled in the art are able to choose, from all these possible additives, both the nature and the quantity of those that will be added to the composition, so that it retains all of its properties. . The invention is illustrated in a nonlimiting manner by the examples below.
    Example 1 Preparation of an alcoholic extract of aerial parts of Solidaeo virsaurea subsp. Alpestris according to the invention
    An alcoholic extract of aerial parts of Solidago virgaurea subsp. Alpstris according to the invention is prepared by a process comprising the following steps: a) extraction with ethanol of the aerial parts (flowers, leaves and stems) dried and crushed Solidago virgaurea subsp. Alpestris, at a temperature of 50 ° C for 3 hours; b) incubating the mixture obtained in a) overnight at 4 ° C; c) filtering the extract obtained in b) on a 100 μm membrane; - decolorization of the liquid filtrate obtained in c) by adsorption of pigments on activated carbon (present in an amount equal to 2% of the dried plant); then - filtration of the decolorized filtrate on a membrane of 20 μm; d) ethanol removal by evaporation, and finally final dilution in 1,3-propanediol (90% solvent). The extract thus obtained is called "Solidage" in the following Examples 2 to 6.
    Example 2: Solidage cytotoxicity assay in normal human keratinocytes and melanocytes
    Protocol:
    Normal human keratinocytes and epidermal melanocytes (PromoCell) from juvenile donors were cultured in 96-well plates for 24 hours in supplemented culture medium (respectively KGM2 and MGM2 + SupplementMix media, Promocell) at 37 ° C, 5% of CO2. The cells were then incubated with different concentrations of Solidage in basal media (without supplement) for 24 hours (keratinocytes) or in media supplemented for 5 days (melanocytes). Cytotoxicity was assessed using Cell Titer 96 Aqueous One Proliferation Solution Assay (Promega), based on the ability of viable cells to reduce colorless / yellow tetrazolium salts to the intensely brown colored formazan derivative. The cells were incubated with tetrazolium at 37 ° C for 30 minutes and the absorbance of formed formazan was read at 490 nm. Results:
    The cytotoxicity of Solidage was evaluated at different concentrations between 0.1 and 0.0125% (Table 1 below).
    Table 1:
    Solidage is not toxic to keratinocytes at all tested concentrations, while it is toxic to melanocytes at 0.1%.
    Example 3 Evaluation of Antioxidant Activity of Solidage
    Protocol:
    For the determination of the ability of Solidage to trap free radicals (hydroxyl, halogenated derivatives, peroxynitrites and superoxide radicals), ie its antioxidant capacity, pholasin-dependent chemiluminescence assays ABEL®1 were used (Knight Scientific Limited) according to the manufacturer's instructions. Briefly, various concentrations of ingredients have been incubated with pholasin, a well-known photoprotein that emits light when it binds to free radicals. D-Mannitol, albumin, vitamin E and L-ascorbic acid were used as positive controls for determining the ability of the extract to trap hydroxyl radicals, halogenated derivatives, peroxynitrites and superoxides.
    All determinations were made in 5 replicates and mean values were determined. The antioxidant capacity of the ingredient is expressed as a percentage reduction in the Pholasin luminescence peak observed during the assay in the presence and absence of the ± SD active, with the untreated control represented at 0%. Results:
    The results obtained are summarized in Table 2 below. At all concentrations tested, Solidage has significant antioxidant activity against hydroxyl radicals, halogenated radicals and peroxynitrites, comparable to that of the highest concentration tested of the compounds used as positive controls. A dose-dependent decrease in the percentage of superoxide capture activity was observed with decreasing
    Solidago.
    Table 2:
    EXAMPLE 4 Determination of the Effect of Solidage on the Activity of Metalloproteases 3 and 9 of the Extracellular Matrix by Fluorometric Assay
    Protocol:
    To evaluate the effect of Solidage on the activity of MMP3 and MMP9, the enzymes (Biomol SE-109 and SE-244, respectively) were incubated with different concentrations of Solidage, each concentration in 5 replicates. The enzymatic reaction was induced by the addition of the specific fluorescent substrate of each MMP enzyme, solubilized in DMSO (Bachem H-2300, M-2055). The enzymatic reaction was followed spectrophotometrically for one hour and the fluorescence measured after excitation / emission at wavelengths of 360/460 nm for MMP3, or 320/405 nm for MMP9. The results are averaged ± SD replicates and shown as% of MMP activity compared to the untreated control, which represents 100%. As a control, EDTA was used for inhibition of MMP activity. Results:
    MMP enzymes are known to be involved in the degradation of the extracellular matrix, and therefore have an impact on the mechanical properties of the skin associated with aging.
    The inventors have thus determined the ability of Solidage to inhibit the activities of MMP3 and MMP9.
    The data summarized in Table 3 indicates that Solidage inhibits both the activity of MMP3 and MMP9 at the highest concentration tested of 0.1%.
    These results show that Solidage can limit the degradation of the extracellular matrix and thus preserve the dermal integrity of the skin.
    Table 3:
    EXAMPLE 5 Evaluation of the Solidage Effect on the Secretion of VEGF and RITTER by Normal Human Keratinocytes in Culture Using Test and JSA
    Protocol:
    The keratinocytes were cultured in a 6-well plate for 24 hours in supplemented medium (KGM2 base medium + SupplementMix, Promocell) before being treated with various solidage concentrations in basal medium for 24 hours. Levels of VEGF and IL1a secreted by keratinocytes in culture media were determined by a standard sandwich ELISA assay (Quantikine, R & D Systems) according to the manufacturer's instructions. The level of secretion of the targeted protein was evaluated on at least two keratinocyte donors cultured in the presence or absence of active. TGFP and UVB, known to increase the level of VEGF and IL1a respectively, were used as positive controls.
    The results presented are means of ± SD organic triplicates and are represented as a percentage of control (which represents 100%). Results: The impact of Solidage was evaluated on the level of secretion of keratinocytes of two specific biological targets: - IL the well-known cytokine involved in inflammation and aging of the skin, and - VEGF, stimulating growth factor micro-vascularization, and thus improving the supply of nutrients and oxygen to the skin.
    Solidage extract inhibits ILla secretion in a dose-dependent manner, with maximal effect (54.1 ± 14.6%) observed at 0.0125% concentration, and UVB stimulates ILla (166 ± 20.6%) relative to untreated cells (100%). Evaluation of keratinocytes treated with 0.1% Solidage showed an increase in VEGF secretion (205.4 ± 20.3%) compared to untreated cells (100%). The results reported from a donor, however, are representative of the two donors tested.
    It is therefore possible to conclude that Solidage is an effective ingredient for the inhibition of pro-inflammatory ILla, while it stimulates VEGF and ensures the nutrition of the skin and its oxygenation, which makes it possible to fight against the aging of the skin. the skin.
    Example 6; Determination of the effect of Solidage on the melanin content in normal human melanocytes in culture
    Protocol:
    Normal human epidermal melanocytes (Promocell) obtained from two high phototype donors were cultured in 96-well plates in supplemented medium (MGM2 + SupplementMix base medium, Promocell). The cells were incubated with growth medium containing various concentrations of Solidage (from 0.05 to 0.0625%) for 5 days. Subsequently, the culture medium was removed and the cells washed with PB S (Gibco / Invitrogen). For the extraction of intracellular melanin, the cells were lysed in 1M NaOH, centrifuged at 12,000 rpm for 5 minutes, and the absorbance of the clear supernatants was measured at 490 nm. Melanin content was normalized to total protein per well at 595 nm (Biorad Protein Assay, Biorad).
    The results are represented in% of the untreated control which is set at 100%. Results:
    Melanin is the chromophore of human skin synthesized by the melanocytes of the epidermis and responsible mainly for the color of the skin. The possible effect of Solidage on skin pigmentation was assessed by chemical quantification of melanin in treated and untreated cells.
    Solidage at a concentration of 0.1% inhibits the melanin content of melanocytes by 21.9 ± 1.9% compared with untreated cells.
    It appears from this test that Solidage modulates the melanin content of normal human melanocytes grown and can therefore reduce the level of pigmentation of the skin (thus act as a depigmenting agent).
    Example 7: Determination of the Effect of Solidaee on the Replicative Life of Primary Human Fibroblasts fHDF)
    Protocol:
    Primary human dermal fibroblasts (HDF) were isolated from tummy tucks of three different female donors aged 49, 58 and 65, provided by Evercyte (Vienna, Austria). The cells were cultured at 37 ° C and 7% CO2 in DMEM F12 / Ham (1: 1) medium from Biochrome (Berlin, Germany) supplemented with 4 mM L-glutamine and 10% fetal calf serum. For serial passages, the cells were washed twice with 1x PBS and incubated with 0.1% trypsin / 0.02% EDTA for 5-8 min. Detaching cells were resuspended in Solidage-containing medium to achieve a final concentration of 0.00625% in the medium. The number of viable cells in 1 ml of cell suspension was determined automatically using a Vi-CELL XR (Beckman Coulter). Results:
    Continuous culture by HDF in the presence of Solidage leads to an extension of the replicative cell life of 10.8% (data not shown).
    EXAMPLE 8 Determination of the Effect of the Continuous Treatment of HDF Cells with Solidage on the Transition of Papillary Fibroblasts to Reticular Fibroblasts (PRT1
    Protocol:
    HDFs were run in series as described in Example 7 and analyzed for PRT by visual inspection of cell morphology under light microscopy, and by quantification of papillary (PDPN) and reticular (TGM2) phenotype markers. Therefore, RNA was isolated using TRI Reagent (Sigma) according to the manufacturer's instructions. Isolated RNA was quantified with a NanoDrop ND-1000 spectrophotometer (Thermo Scientific) and 300 ng were transcribed into cDNA using the NCode VILO miRNA cDNA Synthesis Kit (Life Technologies). Real-time quantitative PCR (qPCR) was performed on a RotorGene-6000 Thermocycler (Qiagen) using Solim BioDyne's HOT FIREPol EvaGreen qPCR Mix Plus (NO ROX) (Tartu, Estonia). Expression of mRNA was normalized to GAPDH expression. The markers and primers used are the following: TGM2: fwd-GGCGAACCACCTGAACAAAC (SEQ ID NO: 1) and rev- AGGATGCAAAGAGGAACGCT (SEQ ID NO: 2), PDPN: fwd-GCATCGAGGATCTGCCAACT (SEQ ID NO: 3) and rev-CCCTTCAGCTCTTTAGGGCG (SEQ ID NO: 4), GAPDH (control): fwd-CGACCACTTTGTCAAGCTCA (SEQ ID NO: 5) and rev-TGTGAGGAGGGGAGATTCAG (SEQ ID NO: 6). Results:
    Continuous culture by serial passage of HDF cells without the presence of Solidage leads to the loss of papillary morphology of HDF, while it is maintained in the presence of Solidage (data not shown).
    This is confirmed by the fact that the expression of the TGM2 marker (lattice marker) is lower, whereas the expression of the PDPN marker (papillary marker) is higher, when the cells are cultured in the presence of Solidage, compared to untreated cells (data not shown).
    It is concluded that Solidage delays the transition of the papillary phenotype to the reticular phenotype of HDF.
    Since younger skin contains a higher number of HDF papillaries, this again suggests that Solidage could help maintain a young skin phenotype.
    Example 9 Determination of the Effect of Continuous Treatment of HDF Cells with Solidage on Senescence Markers
    Protocol:
    The HDFs were passed in series as described in Example 7, and were tested for senescence by labeling associated with β-galactosidase (β-SA-gal). Therefore, the cells were washed twice with 1x PBS and fixed for 10 min with 2% formaldehyde / 0.2% glutaraldehyde. Cells were washed twice with 1 × PBS, once with staining buffer (100 mM citric acid / 200 mM Na 2 HPO 4, pH 6.0) and incubated with staining solution (5 mM ferricyanide potassium, m.p. mM potassium ferrocyanide, 2mM MgCl2, 1mg / ml X-Gal, diluted in staining buffer) at 37 ° C for 24 hours. For each well, 10 photos were taken at random locations in the well, and images from one experiment were randomized and counted blindly by one operator. In addition, qPCR was performed as in Example 9 using primers of the following senescence markers (P21) and young cells (SNEV): p21 C'PI / WAFI (CDKN1A). fwd-GGCGGCAGACCAGCATGACAGATT (SEQ ID NO: 7) and rev-GCAGGGGGCGGCCAGGGTAT (SEQ ID NO: 8), SNEVhPipl9 / hPso4 (PRPF19): fwd-AACCACGGAGCGCAAGAAG (SEQ ID NO: 9) and rev-CGGGGGAAGCAGAAAACAC (SEQ ID NO: 10) ,
    And again normalized with respect to GAPDH mRNA levels. Results: The continuous culture by series passages of HDF in the presence of Solidage leads to a reduction of the senescent cells of approximately 50% at all the times tested during the serial passage of the cells (data not shown). This is reflected by the decrease of p21 mRNA levels as a marker of senescent cells and by the increase of SNEV mRNA levels as a marker of young cells (Voglauer et al., 2006).
    This further confirms the activity of Solidage to delay cell entry into replicative senescence.
    Example 10: Determination of the effect of acute treatment with Solidaee on the senescence marker in senescent HDF prematurely under the effect of stress (HDF SIPS)
    Protocol:
    The cells were seeded on day 0 at 3500 cells / cm 2 and treated at days 1-4 and 7-11 with 100 μl of H 2 O 2 for 1 hour per day and then recovered in normal growth medium. The quiescent control cells were seeded at the same density on day 0 and the medium was changed twice a week. Solidage treatment was performed immediately after the last H202 treatment on day 11.
    HDF SIPS were tested for senescence by labeling associated with β-galactosidase (SA-β-gal) as in Example 10. The qPCR was performed as in Example 10. In addition, after control of the RNA quality isolated with a Bioanalyzer 2100 (Agilent Technologies) using a RNA 6000 Nano Kit according to the manufacturer's instructions, Next Generation Sequencing (NGS) was performed by GATC Biotech (Konstanz, Germany) using an Illumina HiSeq 2500. Results:
    Acute treatment with Solidage decreases the SA-BGal positivity of HDF SIPS by approximately 44% at day 4 and 80% at day 11 (data not shown). This is accompanied by a decrease in p21 mRNA, as well as a positive regulation of SNEV mRNA. Indeed, the principle of principal components analysis (PCA) of the mRNA transcription profiles of the total genome of quiescent and SIPS cells, treated with Solidage compared to untreated cells, shows that Solidage has the effect of converting the profile of the transcriptome to a quiescent cell profile. Specifically, mRNA transcription of several factors of the pro-inflammatory and matrix-degrading senescent-associated secretory phenotype (SASP) has been reduced as illustrated by the examples of IL-11, CXCL8 (IL8). , IFI30 (GILT), and CCL2. Taken together, these results suggest that Solidage is able to reconvert important functional changes that occur upon entry into cellular senescence, and contribute to skin aging.
    Example 11: Determination of the Effect of Solidage Treatment with Solidage on the Long-Term Survival of HDF SIPS Cells
    Protocol:
    The cells were seeded on day 0 at 3500 cells / cm 2 in T75 culture flasks and treated at days 1-4 and 7-11 with 100 μl of H 2 O 2 for 1 hour per day, after which they were recovered in a medium of normal growth. The quiescent control cells were seeded at the same density on day 0 and the medium was changed twice a week. The treatment with Solidage was carried out immediately after the last treatment with H202 on day 11. The counting of the cells was determined as described in example 7. Results: The exposure of HDF SIPS to Solidage for 4 days does not show cytotoxic effect (data not shown). However, exposure to Solidage for more than 35 days results in selective senescent cell killing activity (SESC) of the order of 30%, whereas quiescent cells (controls) do not show a significant amount of death. cellular.
    This indicates that long-term use of Solidage could reduce the number of senescent cells selectively.
    Example 12: Determination of the effect of acute treatment with Solidage on the long-term survival of HDF SIPS
    Protocol:
    Primary human keratinocytes derived from neonatal foreskin from individual donors (KC) were purchased from CellSystems (Troisdorf, Germany) and grown in KC growth medium (KGM, Clonetics, Gaithersburg, USA) supplemented with 0.1 ng / ml d Recombinant human EGF, 5 μg / ml insulin, 0.5 μg / ml hydrocortisone, 0.4% bovine pituitary extract, 50 μg / ml gentamicin and 50 μg / ml amphotericin B. L RNA was isolated using the RNeasy 96 system (Invitrogen), and 900 ng of total RNA was reverse-transcribed with the iScript cDNA Synthesis Kit (Biorad). QPCR was performed using LightCycler 480 and LightCycler 480 SYBR Green I Master (Roche, Basel, Switzerland). The expression of the target genes was normalized with respect to the expression of β-2 microglobulin. The sequences of the primers are as follows (5'-3 '): B2Mf atgagtatgcctgccgtgtg (SEQ ID NO: 11); B2Mr: caatccaaatgcggcatct (SEQ ID NO: 12); pl6ink4Af: caacgcaccgaatagttacg (SEQ ID NO: 13); pl6ink4Ar: accagcgtgtccaggaag (SEQ ID NO: 14); MMP1_524f: ggtctctgagggtcaagcag (SEQ ID NO: 15); MMP1_720r: ccgcaacacgatgtaagttg (SEQ ID NO: 16).
    The cells are inoculated for day 0 stress experiments at 1500 cells / cm 2 and treated at days 2.5 and 6 with Paraquat (PQ) (80 μm) for 24 hours. Solidage treatment was conducted on days 1 and 4 on untreated or Paraquat-treated cells. Results:
    Primary KCs were seeded in culture vessels and treated either with PQ, Solidage, or both. A total of 37,500 cells per culture vessel was seeded at day zero (0), and cell numbers were counted over 3 and 7 days of treatment. The average number of cells counted for the control cells corrected for the cell division factor was: - for the untreated control cells, at D3 of 720,000, at D7 of 8,295,000; for the cells treated with PQ, at D3 of 405,000, at D7 of 546,666; - for cells treated with Solidage, at D3 of 825,000, at D7 of 8,400,000; and for the cells treated with PQ and Solidage, at D3 of 510,000, at D7 of 1,245,000 cells.
    This indicates that Solidage does not prevent the decrease of cell proliferation under the effect of oxidative stress.
    Treatment with Paraquat, a well-described inducer of cellular senescence, induces the expression of MMPI and p16INK4a. P16INK4a is a marker gene for cellular senescence and its expression is upregulated when cells are stopping the cell cycle. MMPI is a matrix metalloprotease that is frequently secreted by senescent cells.
    When Solidage was applied in addition to Paraquat, levels of mRNA expression relative to the control gene (beta-2-microglobulin) were reduced. This indicates that Solidage neutralizes the effect of Paraquat on cell cycle arrest and the expression of genes related to senescence.
    EXAMPLE 13 Cosmetic Compositions 7A - Oil / Water Gel Cream Emulsion
    7b - oil / cream emulsion
    These compositions can be applied daily, morning and / or evening, on the skin.
    权利要求:
    Claims (15)
    [1" id="c-fr-0001]
    1. Alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris, obtainable by a process comprising the following steps: a) extraction of the aerial parts of Solidago virgaurea subsp. alpestris, with at least one alcoholic solvent; b) incubation of the mixture obtained in a) for at least 10 h; c) filtering the incubated mixture obtained in b); and d) removing the solvent from the obtained filtrate and then final dilution in another alcoholic solvent.
    [2" id="c-fr-0002]
    2. Alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to claim 1, characterized in that the alcoholic solvent of step a) is a monoalcohol comprising 1 to 4 carbon atoms, preferably ethanol.
    [3" id="c-fr-0003]
    3. Alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to claim 1 or 2, characterized in that the extraction of step a) is carried out for a period of between 2 and 6 hours, at a temperature between 40 ° C and 60 ° C.
    [4" id="c-fr-0004]
    4. Alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to one of claims 1 to 3, characterized in that the aerial parts are selected from flowers, leaves, stems and mixtures thereof.
    [5" id="c-fr-0005]
    5. Alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to one of claims 1 to 4, characterized in that the incubation of step b) is carried out for a period of between 12h and 30h, at a temperature between 2 ° C and 10 ° C.
    [6" id="c-fr-0006]
    6. Alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to one of claims 1 to 5, characterized in that, between steps c) and d), is added a decolorization step of the filtrate obtained in c), preferably by adsorption on activated carbon, followed by filtration step of the discolored filtrate obtained.
    [7" id="c-fr-0007]
    7. Alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to one of claims 1 to 6, characterized in that the elimination of step d) is by evaporation, and the final dilution is carried out in 1,3-propanediol.
    [8" id="c-fr-0008]
    8. Alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to one of claims 1 to 7, characterized in that it is obtainable by a process comprising the following steps: a) extraction of a mixture of flowers, leaves and stems of Solidago virgaurea subsp . alpestris, previously dried and crushed, with ethanol, at a temperature between 40 ° C and 60 ° C for 2h to 5h; b) incubating the mixture obtained in a) for at least 12 h at a temperature between 2 ° C and 6 ° C; c) filtering the incubated mixture obtained in b) to obtain a filtrate; discoloration of the filtrate obtained in c) by adsorption on activated charcoal; then - filtration of the decolorized filtrate on a membrane of 20 μm; and d) removing ethanol from the filtrate obtained by evaporation and then final dilution in 1,3-propanediol.
    [9" id="c-fr-0009]
    9. Extraction process of aerial parts of Solidago virgaurea subsp. alpestris, comprising the following steps: a) extraction of aerial parts of Solidago virgaurea subsp. alpestris, with at least one alcoholic solvent; b) incubation of the mixture obtained in a) for at least 10 h; c) filtering the incubated mixture obtained in b); d) removing the solvent from the mixture obtained in c), then final dilution in another alcoholic solvent.
    [10" id="c-fr-0010]
    10. Cosmetic use of an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to any one of claims 1 to 8 for the prevention and / or the attenuation of skin changes due to aging.
    [11" id="c-fr-0011]
    11. Cosmetic use of an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to any one of claims 1 to 8 as a depigmenting agent.
    [12" id="c-fr-0012]
    12. Cosmetic use of an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to any one of claims 1 to 8 as skin microcirculation improving agent and / or epidermal regenerating agent, for improving the color and / or the radiance and / or uniformity of the complexion of the skin; to prevent the appearance of a dull skin and / or without glare and to bring to the skin a regular and radiant complexion.
    [13" id="c-fr-0013]
    13. Cosmetic use of an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to any one of claims 1 to 8 as an antioxidant.
    [14" id="c-fr-0014]
    14. Cosmetic or dermatological composition comprising, in a cosmetically or pharmaceutically acceptable vehicle, an alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris according to any one of claims 1 to 8.
    [15" id="c-fr-0015]
    15. Cosmetic or dermatological composition according to claim 14, characterized in that it is suitable for topical application.
    类似技术:
    公开号 | 公开日 | 专利标题
    CA2395283C|2010-03-23|Use of an extract of at least one plant of genus vaccinium as antiglycation agent
    EP3173065B1|2018-02-28|Alcoholic extract of aerial parts of solidago virgaurea subsp. alpestris, process of preparation thereof, and cosmetic or dermatological composition comprising such an extract
    EP2953611B1|2021-08-18|Use of a composition comprising avocado perseose in the protection of epidermal stem cells
    FR3010313A1|2015-03-13|COMPOSITION COMPRISING A GUACATONGA EXTRACT AND AROEIRA EXTRACT, USE THEREOF, AND METHOD FOR PREVENTING AND / OR TREATING SIGNS CAUSED BY SKIN AGING
    EP3119382B1|2020-03-25|Cosmetic and pharmaceutic applications of vescalagine and castalagine
    FR3018191A1|2015-09-11|COSMETIC USES OF SWERTIAMARIN
    FR2987998A1|2013-09-20|COSMETIC COMPOSITION COMPRISING A SYNERGISTIC ACTION TRF2 PROTEIN ACTIVATION SYSTEM COMPRISING AN ASSOCIATION OF PEPTIDE EXTRACT OF SOY AND YEAST AND USES THEREOF
    WO2017129779A1|2017-08-03|Dermatological or cosmetic compositions containing a polyphenol-enriched extract of vitex negundo
    FR2962330A1|2012-01-13|Cosmetic use of an extract of Musa sapientum to stimulate the production of collagen type I to fight against skin aging and to prevent and/or limit the appearance of signs of skin aging
    FR3076461A1|2019-07-12|Cosmetic composition of active prevention signs of age.
    FR3051369B1|2019-06-14|BEET HINT EXTRACTS, COMPOSITIONS AND USES
    WO2019077268A1|2019-04-25|Cosmetic composition for active prevention of the signs of ageing
    FR3023164A1|2016-01-08|PEPTIDE EXTRACTS FROM LUPINE AND CLOSURE OF THE SKIN
    WO2018096039A1|2018-05-31|Extracts of plants from the tagetes genus and uses of same
    WO2013102728A1|2013-07-11|Polar extract of kniphofia uvaria, cosmetic or dermatological composition containing same, and uses thereof
    EP3280387B1|2019-07-03|Novel uses of the peptide of sequence his-d-trp-ala-trp-d-phe-lys-nh2 for reducing or delaying the appearance of cell senescence and signs of skin ageing
    FR3031458B1|2019-06-07|SALAD EXTRACTS, COMPOSITIONS AND USES
    FR3018685B1|2019-08-09|COSMETIC AND PHARMACEUTICAL APPLICATIONS OF SALICARIA
    FR3110345A1|2021-11-26|Moringa peregrina seed meal protein hydrolyzate for its application as a medicament, its production process and pharmaceutical, dermatological and cosmetic compositions.
    WO2021152250A1|2021-08-05|Cosmetic, nutraceutical or dermatological use of a tamarindus indica l. extract and/or a composition comprising it
    FR3070864A1|2019-03-15|PHARMACEUTICAL AND / OR COSMETIC COMPOSITION COMPRISING AN AQUEOUS EXTRACT OF PANCRATIUM MARITINUM AND USES THEREOF
    FR3095754A1|2020-11-13|Pentacyclic triterpenes in the treatment of vitiligo
    FR2997854A1|2014-05-16|Use of Saba senegalensis extract for performing anti-aging action on skin and its annexes or mucous membranes, preferably e.g. preventing, delaying and/or limiting the signs of endogenous or exogenous skin aging
    FR2891146A1|2007-03-30|Vanilla planifolia extract useful e.g. to prevent and/or treat skin deteriorations due to aging or physiological mechanisms related to aging, comprises a liposoluble fraction
    同族专利:
    公开号 | 公开日
    JP6449216B2|2019-01-09|
    JP2017105761A|2017-06-15|
    US20170151170A1|2017-06-01|
    EP3173065A1|2017-05-31|
    US10206867B2|2019-02-19|
    EP3173065B1|2018-02-28|
    FR3044226B1|2017-12-08|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US20090004302A1|2004-10-15|2009-01-01|Biopharmacopae Design International Inc.|Methods and Therapeutic Compositions Comprising Plant Extracts for the Treatment of Cancer|
    US20090214677A1|2005-09-01|2009-08-27|Elso Magyar Biodrog Kutató És Fejleszto Kft|Pharmaceutical Composition Containing an Extract of a Solidago Species|
    WO2010072923A1|2008-12-23|2010-07-01|Universite De Nice Sophia-Antipolis|Composition containing saponins|
    HU0500948A2|2005-10-14|2007-08-28|Mendon Trade & Commerce Lc|Composition for treatment of diabeticus paradontosis|EP3501608B1|2017-12-21|2020-06-24|Chanel Parfums Beauté|Alcoholic extract of aerial parts of anthyllis vulneraria, method for obtaining same, and cosmetic or dermatological composition containing same|
    KR102117661B1|2018-11-26|2020-06-02|주식회사 예나|Cosmetic composition for skin anti-wrinkle and anti-aging containing extracts of Chrysanthemum zawadskii subsp. lucidumY.N.Lee, Solidago virgaurea and Anthriscus sylvestris|
    WO2021184125A1|2020-03-19|2021-09-23|Idunn Technologies|Discovery of fifteen new anti-aging plant extracts and identification of cellular processes they affect as new caloric restriction mimetics|
    CN112716858B|2021-01-29|2021-11-16|广州辰美化妆品有限公司|Plant composite whitening and freckle removing nursing composition, and emulsion and cream containing composition|
    法律状态:
    2016-09-30| PLFP| Fee payment|Year of fee payment: 2 |
    2017-06-02| PLSC| Publication of the preliminary search report|Effective date: 20170602 |
    2017-11-28| PLFP| Fee payment|Year of fee payment: 3 |
    2018-11-29| PLFP| Fee payment|Year of fee payment: 4 |
    2020-10-16| ST| Notification of lapse|Effective date: 20200910 |
    优先权:
    申请号 | 申请日 | 专利标题
    FR1561400A|FR3044226B1|2015-11-26|2015-11-26|ALCOHOLIC EXTRACT OF AIR PARTS OF SOLIDAGO VIRGAUREA SUBSP. ALPESTRIS, METHOD FOR PRODUCING THE SAME, AND COSMETIC OR DERMATOLOGICAL COMPOSITION CONTAINING SAME|FR1561400A| FR3044226B1|2015-11-26|2015-11-26|ALCOHOLIC EXTRACT OF AIR PARTS OF SOLIDAGO VIRGAUREA SUBSP. ALPESTRIS, METHOD FOR PRODUCING THE SAME, AND COSMETIC OR DERMATOLOGICAL COMPOSITION CONTAINING SAME|
    US15/361,176| US10206867B2|2015-11-26|2016-11-25|Alcoholic extract of aerial parts of Solidago virgaurea subsp. alpestris, method of production thereof, and cosmetic or dermatological composition containing it|
    EP16200796.7A| EP3173065B1|2015-11-26|2016-11-25|Alcoholic extract of aerial parts of solidago virgaurea subsp. alpestris, process of preparation thereof, and cosmetic or dermatological composition comprising such an extract|
    JP2016228983A| JP6449216B2|2015-11-26|2016-11-25|Alcohol extract of above-ground part of Solidago virgaurea subsp. Alpestris, method for producing the same, and cosmetic or dermatological composition containing the same|
    [返回顶部]